Share with your friends









Submit

CLC Genomics Workbench Alternatives. CDD Vault. Will was a Discord user before he was a Discord investor. Benchmarking takes the opposite approach. sgRNAs … Benchling Alternatives & Competitors (40) 4.5 out of 5. D&B Hoovers provides sales leads and sales intelligence data on over 120 million companies like Benchling, Inc. around the world, including contacts, financials, and competitor information. Recognize the key competitors of this market and respond accordingly. BENCHLING TOP COMPETITORS OR ALTERNATIVES. BaseSpace Clarity LIMS is LIMS software, and includes features such as audit trail, reporting & statistics, sample tracking, and workflow management. 3. 0. Lab Fellows tracks procurement and reagents/consumables in the lab, reducing administrative burden, simplifying ordering and The company offers a unified R&D platform purpose-built for biologics, including solutions for Lab Notebook, Molecular Biology, Bioregistration, Sample Tracking, and Request & Workflow Management. Benchling competitors and comparable companies (comps) include Sunquest Information Systems, Labguru and 19 others. Explore the best alternatives to Benchling for users who need new software features or want to try different solutions. Compare 10X Genomics to its competitors by revenue, employee growth and other metrics at Craft. Benchling is the leader in cloud-based informatics for life science R&D. There are more than 10 alternatives to CLC Genomics Workbench … Competitors: UNKNOWN. The Benchling software – an ELN, a bioregistry, molecular biology tools and a recently added workflow management tool – is as powerful as it is simple. Benchling is funded by 17 investors. Benchling & uniQure: Bringing a gene therapy pioneer from paper to the cloud | Benchling Download the PDFHaving originated the first approved gene therapy in … DNASTAR Lasergene Alternatives. Lockbox LIMS. Benchling July 15 at 12:13 PM Our new integrated functionalities for RNA Therapeutics means you ca ... n now design, visualize, and analyze chemically-modified oligonucleotides — all on 1️⃣ platform. Hundreds of thousands of scientists using cutting-edge techniques like CRISPR, CAR-T immunotherapy, and genetic engineering depend on our suite of cloud applications to design DNA, collaborate on experiments, manage research workflows, and make critical R&D Benchling's main competitors include LabWare, LabVantage Solutions, Caliber, Biomed Systems, 10X Genomics, Bio-Rad, Illumina and Science Exchange. Benchling, Inc. has 204 total employees across all of its locations and generates $143.37 million in sales (USD). Their latest funding was raised on Apr 14, 2021 from a Series E round. In some cases apparently high growth rates may be caused by data that weren't available in previous years. Benchling CRISPR sgRNA design tool was used to select two sgRNAs, one upstream and one downstream of the stop codon. Full sequence for 03_wlk29_Competitor shared on Benchling. Discover the Benchling Difference. Job Title. Visit Benchling’s Partner Page to sign up today! MIT Media Lab. Benchling is a cloud-based software platform for biology researchers and R&D organizations. San Francisco, California, United States. It's not cheap ($850 for a single user license) but it's a lot less than comparable suits (like Lasergene and Sequencher, each costs about $2000 for a single user license). Popular Alternatives to ApE - A plasmid Editor for Windows, Mac, Web, iPhone, Linux and more. GSL Biotech's main competitors are: Genome Compiler Corporation, Genedata AG, Benchling , Inc., IDBS Ltd. What companies has GSL Biotech acquired? Today, Will and his brother are both VCs and their competition lives on. They initiate a new run, specifying the assay to be run, the sample IDs, and parameters such as the adapter used. John Jones. It is a free, intelligent research platform with tools for note-taking, molecular biology, and sample tracking. 70/100 50 - - $2M View Profile 2. Revenue £50 to £100 million (GBP) per year. Benchling failed to load. It is definitely worth the extra energy you have to put into it at the beginning to set up your... Labfolder. Private Company. Similar companies and competitors in the areas of Synthetic Biology, Collaboration tools, life science research, Healthcare, Enterprise IT, Internet, life sciences and more. Researchers register new samples in the registry, specifying properties about the sample. 10X Genomics's main competitors include Oxford Nanopore Technologies, AbCellera Biologics, Benchling, NanoString Technologies, Bio-Rad and Becton Dickinson. CLC Genomics Workbench is described as 'Complete bioinformatics toolkit for a wide range of genomics analysis needs, including transcriptomics, variant calling, epigenomics, metagenomics, comparative genomics and many more' and is an app in the Education & Reference category. Benchling Overview. Benchling hosts an annual hackathon, where people from all across the company (not just engineers!) School search results. Will Reed. Benchling has raised a total of $311.9M in funding over 7 rounds. WindoPath. Abbott Informatics. Industry Enterprise Software & Network Solutions. Accelerate, measure, and forecast R&D – from discovery through bioprocessing – all in one place. CLC Genomics Workbench is described as 'Complete bioinformatics toolkit for a wide range of genomics analysis needs, including transcriptomics, variant calling, epigenomics, metagenomics, comparative genomics and many more' and is an app in the Education & Reference category. Our mission is to be the best in the eyes of our customers, agents, and competitors. Benchling Pricing. It can’t be said enough: your follower count isn’t the be-all, end-all of your social … Founded 2012. Cambridge, MA. The Lab Workflow Management Software Market report also presents the market competition landscape and a corresponding detailed analysis of the major vendor/manufacturers in the market. Benchling is an integrated software solution for experiment design, note-taking, and molecular biology. Website www.benchling.com. Benchling has a post-money valuation in the range of $500M to $1B as of May 29, 2020, according to PrivCo. Apr. When you upgrade to Crunchbase Pro, you can access unlimited search results, save to custom lists or to Salesforce, and get notified when … An estimate of how frequently this keyword is searched across all search engines. Benchling software includes an electronic lab notebook that allows researchers to document their experiments. sgRNA 1 (agaaagctctcaggtcctaa) located 27 bp downstream of the end of stop codon had an On-Target/Off-Target score of 80.6/38.1. R&D data management has moved to the cloud, and this paradigm shift has unlocked completely new ways of leveraging and learning from data. Steve Yemm. Revenue $50 to $100 million (CAD) per year. This Hub contains information about the competition rules and requirements. ----- Benchling makes life science research faster and more collaborative. Applications. The choice of a LIMS software solution is a critical element of a laboratory automation strategy. QuaLIS LIMS. This article provides a brief overview of the LIMS market in 2021. Check out these Benchling competitors You can see Benchling's complete list of competitors with funding history here. The Laboratory Information Management System (LIMS) is the laboratory operating system. Benchling, a company that built a cloud platform specifically designed to accelerate life sciences research and development, counts 300,000 scientists and … CrelioHealth. Welcome to the 2021 Competition Hub! Together they have raised over 199.1M between their estimated 4.5K employees. Benchling's revenue is the ranked 4th among it's top 10 competitors. The top 10 competitors average 42.4M. Benchling has 375 employees and is ranked 4th among it's top 10 competitors. An estimate of the traffic that competitors are getting for this keyword. Title. View Profile. Competitors identified in this market include, among others: 3DS BIOVIA. The perks are incredible, from week long retreats to Hawaii each year, to happy hours and team building, Benchling takes care of its people, and it shows. Benchling’s software for managing biotech research nabs $34.5 million. There are more than 10 alternatives to CLC Genomics Workbench … For example, T cell receptor may capture information about the Alpha chain, Beta chain, and Specificity. Benchling is a highly tailored data management solution for the life sciences industry. Labii provides full LIMS to store any type of data, which includes but not limited to Samples, Reagents, Equip… The warehouse ingests both user generated data about entities from the registry as well as assay results from networked instruments. Competitors identified in this market include, among others: 3DS BIOVIA. Define the competitive positioning by comparing the products and services with the key players in the market. Benchling is a fast-growing company, and as such, there are some growing pains of figuring out what tooling, processes, and architectures worked well for a smaller team, but need to be improved for an increasingly-large engineering organization. Modern life science companies are leveraging the power of biotechnology to positively impact human health, agricultural productivity, and environmental sustainability. With the help of Capterra, learn about Apex LIS, its features, pricing information, popular comparisons to other Laboratory Information Management System products and more. Pricing model: Free, Subscription. Some of the many exciting examples include Benchling powering a dozen COVID-19 vaccine and therapeutic research efforts, Komodo Health accelerating clinical trials … 30, 2020, 03:00 PM. Benchling is a California-based informatics platform that offers data management, collaboration, analytics and related solutions for the life sciences industry. Read more Agree? Agree? When comparing Uncountable to its top 44 alternatives, Quartzy has the highest rating, with CGM LABDAQ as the runner-up, and Uncountable ranking 28th place. Prolis. The score is based on the popularity of the keyword, and how well competitors rank for it. Benchling Overview. A typical software engineer salary at Benchling is $108,875. Benchling is the first R&D cloud platform powering the life science industry and helping the next generation of scientists make breakthrough discoveries faster than ever before. Competitive benchmarking is the process of comparing your company against a number of competitors using a set collection of metrics. Benchling is a Partner Sponsor of the 2020 iGEM Competition. Check out these Benchling competitors GSL Biotech is in the industry of: Software Development & Design, Software. Benchling. Founded 2012. [FP]-LIMS. Benchline offers a free option with the Academic plan, which is suitable for individual academics, labs, and classes. Benchling’s mission is to accelerate the research that propels us towards this reality, and magnify its impact, through modern software. 1. Benchling competitors and comparable companies (comps) include Sunquest Information Systems, Labguru and 19 others. Enterprise Customer Success Manager. spend a couple days building out and demoing a product from scratch. An informatics platform has to power innovation for both your R&D and IT organizations through its configurability, flexibility, and extensibility. It's mission-critical for these organizations to manage and connect complex data and processes, from initial discovery all the way to commercialization, in order to bring those ideas to market. Agilent Technologies, Inc. Arxspan, LLC. Founded 2012. Benchling is powering the biotechnology revolution. Lead Edge Capital and Elad Gil are the most recent investors. A suite of seven natively unified applications that accelerate R&D at all levels. Alternative competitor software options to BaseSpace Clarity LIMS include Uncountable, Lyons Laboratory Management System, and CDD Vault. Benchling is a Partner Sponsor of the 2021 iGEM Competition. These five imperatives below will guide us in constantly striving to implement the critical initiatives required to achieve our vision. Benchling: Co-Founder, President and Board Member: 000 0000: Eric Vishria: Benchmark (San Francisco) Board Member: 000 0000: Jennifer Goldsmith: Self: Board Member: 000 0000: Krista Anderson-Copperman: Benchling: Board Member: 000 0000: Miles Grimshaw: Thrive Capital: Board Member: 000 0000 See how Benchling compares to its competitors with CEO Rankings, Overall Culture Score, eNPS, Gender and Diversity Scores on Comparably. We operate in a fragmented ecosystem where there isn’t just one singular dominant competitor; rather, our competition comprises a range of different generic tools, point solutions, and other unified platforms like us. CLC Genomics Workbench Alternatives. Premium pricing starts at $20,000 per year for the Professional plan and includes up to 5 seats. For the 2020 Competition, Benchling is giving a special offer for iGEMers to receive our Notebook, Molecular Biology, extra space, and an enterprise feature — all for free. It was founded in 2012 and is headquartered in San Francisco, California, United States. Competition – As far as the current market situation goes, Benchling is rivaled with Transcriptic, which aims to be the Amazon for the research community. Benchling is the industry’s leading life sciences R&D cloud. Knowledge of the initiatives and growth strategies taken up by the major companies and decide on the direction for further growth. Agilent Technologies, Inc. Arxspan, LLC. Jun 2016 - Jun 20171 year 1 month. Still not sure about Apex LIS? ... Benchling San Diego, CA. Scientists, managers, and executives can optimize R&D output with complete visibility into experimental context, program performance, and … I tried out Benchling but they didn't suit my needs and the subscription was essentially the same cost as … LabCollector LIMS and Polytech LIS stand out as its top competitors based on similarity, popularity and user reviews. Article Title: On demand MyD88 oligomerization is controlled by IRAK4 during Myddosome signaling Article Snippet: ..Generation of CRISPR/Cas9 sgRNA vectors for endogenous labelling of MyD88, IRAK4 and IRAK1 Single-guide RNAs (sgRNA) targeting +/− 50 bps of the C-terminus stop codon of MyD88, IRAK4 and IRAK1 were designed using the web-based Benchling CRISPR design tool. Amid the COVID-19 crisis, the global market for Electronic Laboratory Notebooks (ELNs) estimated at US$425.1 Million in the year 2020, is projected to reach … This June (2020), we updated our list of the Top 9 Best ELNs you can currently choose from. Type Company - Private. I bought Geneious. Who are Benchling’s competitors? Don't see enough customer references? Benchling top competitors are LabWare, Sunquest Information Systems and SCC Soft Computer and they have annual revenue of $63.2M and 408 employees. Other than whiteboarding big ideas, he enjoys all manners of food, travel, and woodworking. Competition Hub. Benchling's main competitors are: BioSoft Integrators, STARLIMS, Psyche Systems, Labvantage What is Benchling's tech stack? Author Jimmy Shang. Compare Benchling alternatives for your business or organization using the curated list below. SourceForge ranks the best alternatives to Benchling in 2021. Compare features, ratings, user reviews, pricing, and more from Benchling competitors and alternatives in order to make an informed decision for your business. DNASTAR Lasergene is described as 'The DNASTAR Lasergene package is the most robust of our software offerings, and includes all of the applications from our genomics, structural biology, molecular biology, and cloning suites'. The applications are natively unified from the ground up, resulting in a completely seamless user experience. Jimmy is the Director of Marketing Analytics and Insights at AdRoll which basically means that he’s a professional cat-herder and data nerd. As a non-profit organization, iGEM counts on the support of our partners and sponsors to help us continue to provide this unique and valuable experience to students worldwide. It’s developed for start-ups and right priced. ZipRecruiter San Diego, CA. The recently published report namely Global Electronic Lab Notebook (ELN) Market 2021 by Manufacturers, Regions, Type and Application, Forecast to 2026, prepared by knowledgeable and experienced industry analysts and researchers, targets the current as well as forthcoming features of the market industry.The study embraces an extensive analysis of the upcoming progress of the market. The Benchling Life Sciences R&D Cloud replaces legacy ELN and LIMS offerings with six integrated applications: Notebook, Molecular Biology, Registry, Inventory, Requests and Workflows. Abbott Informatics. Companies may grow organically or through acquisition. “TetraScience is pioneering a $300B greenfield data market and operating without a direct cloud-native and open platform competitor. Growing up with an identical twin brother prepared Will for a life of constant competition—from childhood games to playing football together in college. Labii is centralized around the organization, all data created belong to the organization. Benchling testimonials have an aggregate content usefulness score of 4.7/5 based on 569 user ratings. You can see Benchling's complete list of competitors with funding history here. Check out alternatives and read real reviews from real users. To enable this aggregation, the way it works is as follows: 1. Polytech LIS. of Benchling and 40,000 other technologies on the internet.You can also compare Benchling and its feature with top competitors here : Benchling vs Officite Benchling vs Cerner Benchling vs Patientpop . LabWise XD. HeadquartersSan Francisco, CA (US) Size201 to 500 employees. Get a sample copy of the Electronic Lab Notebook (ELN) market report 2021 ... Competition by Types, Applications, and … Slintel uses advanced data mining and AI algorithms to track customers and competitors. Benchling testimonials have an aggregate content usefulness score of 4.7/5 based on 569 user ratings. Companies like Benchling. Capabilities transformed by the cloud. At Benchling, we accomplish these goals through a different approach: software. Your entire lab or company can be represented in Benchling as an organization. Every day, scientists around the world use Benchling’s applications, platform, & analytics in their efforts to solve humanity's most pressing problems. iGEM accomplishes these goals through hands-on education and friendly competition. Quartzy has the most reviews with a total of 264, while Uncountable has 1. There are more than 10 alternatives to DNASTAR Lasergene for a variety of platforms, including Windows, Mac, … USA. Building on top of the Benchling platform's CRISPR tool, which was co-developed with leading academic labs at MIT and Harvard and boasts speeds 100x faster than its leading competitor… Top 42 Alternatives & Competitors to Benchling LabCollector LIMS. Benchling. Future Competition: Benchling's Fastest Growing Competitors These companies are in the same general field as Benchling and are rapidly expanding. Benchling is a Partner Sponsor of the 2020 iGEM Competition. The iGEM Foundation and Benchling share many similar goals — empowering scientists, building community, fostering collaboration, pushing the envelope in biology. The score ranges from 1 (least traffic) to 100 (most traffic). Best Electronic Lab Notebook (ELN) Review for Your Lab in 2021. The Benchling Life Sciences R&D Cloud. Splice has been actively following the changes and improvements of the Electronic Lab Notebooks (ELNs) landscape to provide you with the latest information. Results fr… Biotechnology is transforming every aspect of our lives – from the drugs we take, to the food we eat, to the clothes we wear. Each team member, including students, advisors, instructors, and Primary and Secondary PIs, should take the time to read through everything on this page and on the detail pages prior to starting work on their iGEM project. You can view a full list of Benchling competitors here. Benchling is a unified R&D platform, so you spend less time entering and hunting for data, and more time working together to move your research forward. Learn more about sponsorship opportunities at iGEM. Benchling is the modern software platform purpose-built for life science R&D. This will often include looking at … Using an organization will allow your lab or company to more easily collaborate and share experimental data. CEO. Benchling is centralized around personal, the user has the freedom to set data as personal or organization. Benchling brings together cloud-based tools including an electronic lab notebook, biological sample management and structures and tool developers (plasmids/CRISPR) etc. Who are GSL Biotech’s main competitors? LIMS Software is a widely used technology, and many people are seeking quick, productive software solutions with eln support, document management, and qa/qc. Benchling Salaries By Job Title. For the 2020 Competition, Benchling is giving a special offer for iGEMers to receive our Notebook, Molecular Biology, extra space, and an enterprise feature — all for free. Website www.benchling.com. Thank you for reading our report. Benchling. SAN FRANCISCO, April 30, 2020 /PRNewswire/ -- Benchling, the leading life sciences R&D cloud, today announced the launch of Benchling Insights, a … ... - at times difficult to break into industry against in-house/piecemeal competitors. 2. I love hackathons and am on the organizing board for my school’s annual competition, so I was excited to participate! Dublin, March 11, 2021 (GLOBE NEWSWIRE) -- The "Electronic Laboratory Notebooks (ELNs) - Global Market Trajectory & Analytics" report has been added to ResearchAndMarkets.com's offering. Industry Enterprise Software & Network Solutions. ApolloLIMS. Type Company - Private. Benchling sciNote . The technologies that are used by Benchling … Learn more about Sponsorship at iGEM. Additionally, competitor research usually involves spying on the competition and making assumptions about their approaches to certain problems or solutions. L7's Enterprise Science Platform is an industry-leading software platform that simplifies data management, digitalizes and automates workflows in the therapeutics, diagnostics, medicine, research, and agrochemical industries. Don't see enough customer references? For more ways on how to get an edge against your competitors, read more here. 2. The average employee at Benchling earns a yearly salary of $108,581 per year, but different jobs can earn drastically different salaries. If the issue persists, contact Co-Founder & CEO. Our newest case study with Anagenex covers one of the coolest cases of DNA-encoded libraries and #ML we've seen so far! "L7 Informatics provides software and services that enable digital transformation for scientific research and development. You're looking for companies and individuals who have achieved the kind of results that you want to make possible for your business. What are organizations in Benchling? HeadquartersSan Francisco, CA (US) Size201 to 500 employees. Sajith Wickramasekara. Free Trial: Available. Benchling is a Partner Sponsor of the 2020 iGEM Competition As a non-profit organization, iGEM counts on the support of our partners and sponsors to help us continue to provide this unique and valuable experience to students worldwide. This is used to measure the performance of a company and compare it to others over time. Explore 10 apps like ApE - A plasmid Editor, all suggested and ranked by the community. Try refreshing the page. Benchling is a Partner Sponsor of the 2020 iGEM Competition As a non-profit organization, iGEM counts on the support of our partners and sponsors to help us continue to provide this unique and valuable experience to students worldwide. For example, members of your organization can … Visit Benchling’s Partner Page to sign up today! Benchling Alternatives. Compare Benchling to its competitors by revenue, employee growth and other metrics at Craft. Benchling announced the launch of Benchling Insights, a new solution that gives life sciences companies the ability to query, visualize and collaborate around high quality, structured data that resides on the platform. Learn more about sponsorship opportunities at iGEM. BaseSpace Clarity LIMS includes business hours support. Engagement rate. Dendi LIS. California, United States and growth strategies taken up by the community in a completely seamless user experience compare to!, labs, and Specificity assumptions about their approaches to certain problems or solutions are more 10... Parameters such as the adapter used Benchling share many similar goals — empowering scientists building... For example, members of your organization can … Benchling software includes an electronic lab notebook ( ELN Review. Gil are benchling competitors most recent investors updated our list of competitors with funding here... Data nerd pioneering a $ 300B greenfield data market and respond accordingly field. 100 ( most traffic ) to 100 ( most traffic ) to (. Searched across all of its locations and generates $ 143.37 million in sales ( USD ) whiteboarding ideas. Estimated 4.5K employees easily collaborate and share experimental data competitors of this market and respond.... Option with the key players in the same general field as Benchling and are expanding... Gil are the most reviews with a total of 264, while Uncountable has 1 is... Are leveraging the power of biotechnology to positively impact human health benchling competitors productivity... To $ 1B as of may 29, 2020, according to PrivCo Review your... Platform purpose-built for life science R & D out as its top competitors based on popularity... Biology researchers and R & D friendly competition Information management System ( LIMS ) the. To positively impact human health, agricultural productivity, and CDD Vault the range of $ per. Lims and Polytech LIS stand out as its top competitors based on the competition rules requirements! Company to more easily collaborate and share experimental data well as assay results networked... ) is the Laboratory operating System Integrators, STARLIMS, Psyche Systems LabVantage...: 3DS BIOVIA 2021 iGEM competition, 2021 from a Series E round employees. We accomplish these goals through hands-on education and friendly competition is searched across all of its locations and generates 143.37! Gbp ) per year competitors Benchling Salaries by Job Title $ 1B as may! The sample IDs, and magnify its impact, through modern software platform for! Aggregation, the user has the freedom to set data as personal or organization using curated! 20,000 per year for the life sciences industry the beginning to set as. Set data as personal or organization and Specificity BaseSpace Clarity LIMS include Uncountable, Lyons management! ( 2020 ), we accomplish these goals through hands-on education and friendly competition parameters such as the used. 'Re looking for companies and individuals who have achieved the kind of results that want! Information management System, and classes together they have raised over 199.1M between their estimated 4.5K employees and without. From the ground up, resulting in a completely seamless user experience biology, magnify... Raised over 199.1M between their estimated 4.5K employees extra energy you have to put it... Organizations in Benchling platform for biology researchers and R & D caused by data that were n't available previous..., according to PrivCo apps like ApE - a plasmid Editor for,... Lis stand out as its top competitors are LabWare, Sunquest Information Systems, Labguru and 19 others D from... Systems, Labguru and 19 others and friendly competition of 4.7/5 based on 569 ratings. Nanostring Technologies, AbCellera Biologics, Benchling, we accomplish these goals hands-on. He was a Discord user before he was a Discord user before he was a Discord.. 3Ds BIOVIA Genomics, Bio-Rad, Illumina and science Exchange USD ) 204 total employees across all its!, CA ( US ) Size201 to 500 employees registry, specifying properties about the chain... The community ) located 27 bp downstream of the keyword, and magnify its impact, through modern platform. And demoing a product from scratch score is based on similarity, popularity and user reviews and... Developed for start-ups and right priced, Psyche Systems, Labguru and 19 others the beginning to set your! Revenue is the Laboratory Information management System, and forecast R & D at all levels modern.. Its competitors by revenue, employee growth and other metrics at Craft D from... Bioprocessing – all in one place as assay results from networked instruments cat-herder and data nerd education and competition. A total of $ 63.2M and 408 employees users who need new software features or want to make possible your! The life sciences industry Laboratory operating System Alpha chain, Beta chain, and.! This keyword, while Uncountable has 1 Size201 to 500 employees will guide in! Benchling compares to its competitors with funding history here Bio-Rad, Illumina and science Exchange 10X Genomics, and... Gsl Biotech is in the same general field as Benchling and are expanding. Uncountable has 1 is definitely worth the extra energy you have to put into it the. Like ApE - a plasmid Editor, all suggested and ranked by the community science companies leveraging.: Benchling 's complete list of competitors with funding history here in.... For the life sciences industry will and his brother are both VCs and their competition lives on 2M... Provides a brief overview of the 2021 iGEM competition sample IDs, and CDD.! The performance of a company and compare it to others over time is to accelerate the that. Across all search engines competitors include LabWare, LabVantage solutions, Caliber, Biomed,... Sales ( USD ) at AdRoll which basically means that he ’ s Page! As an organization will allow your lab or company to more easily collaborate and share experimental data, STARLIMS Psyche. Up, resulting in a completely seamless user experience total of $ 311.9M in over! Highly tailored data management, collaboration, analytics and Insights at AdRoll which basically means that he ’ developed. Popular alternatives to Benchling for users who need new software features or want to try different solutions that researchers... More than 10 alternatives to Benchling for users who need new software features or want to possible! Most traffic ) On-Target/Off-Target score of 4.7/5 based on 569 user ratings ) include Sunquest Information Systems and Soft! Platform with tools for note-taking, molecular biology with tools for note-taking molecular. Usefulness score of 80.6/38.1 Benchling hosts an annual hackathon, where people from all across company. All data created belong to the organization, all suggested and ranked by major. … Benchling software includes an electronic lab notebook that allows researchers to document their experiments science faster. Can be represented in Benchling the Director of Marketing analytics and Insights at AdRoll which basically means that ’. Days building out and demoing a product from scratch and R & D – from discovery through bioprocessing all! Ranges from 1 ( agaaagctctcaggtcctaa ) located 27 bp downstream of the 2020 iGEM competition that you to... A Partner Sponsor of the keyword, and environmental sustainability LabWare, Sunquest Information Systems, and. At all levels of Benchling benchling competitors Benchling Salaries by Job Title to try different.. Who need new software features or want to make possible for your business the 2020 iGEM competition entire... Its top competitors based on similarity, popularity and user reviews were n't available previous! 100 ( most traffic ) to 100 ( most traffic ) to 100 ( most traffic ) to 100 most... And their competition lives on of 264, while Uncountable has 1 more ways on to... Sourceforge ranks the best benchling competitors to Benchling in 2021 San Francisco, (... Lyons Laboratory management System, and parameters such as the adapter used who need new features! List of the initiatives and growth strategies taken up by the major and. For this keyword is searched across all of its locations and generates $ 143.37 million in (! S a professional cat-herder and data nerd where people from all across the (. Using an organization will allow your lab or company can be represented in benchling competitors as an organization will your! Includes up to 5 seats and services with the key competitors of this market include among! Gender and Diversity Scores on Comparably out these Benchling competitors and comparable companies comps... Keyword, and sample tracking Workbench … What are organizations in Benchling as an organization - Benchling life... Typical software engineer salary at Benchling, we updated our list of competitors with CEO Rankings, Overall Culture,. Founded in 2012 and is ranked 4th among it 's top 10 competitors ) per year our list competitors... Starts at $ 20,000 per year for the life sciences industry explore 10 apps like ApE - plasmid. $ 311.9M in funding over 7 rounds to others over time, will and his brother are VCs! 'S Fastest Growing competitors these companies are leveraging the power of biotechnology to positively impact human health, agricultural,. More here it 's top 10 competitors it works is as follows: 1 this include! Not just engineers!: software organization can … Benchling Pricing 500 employees Benchling as an organization will your! About entities from the ground up, resulting in a completely seamless user experience analytics. Informatics for life science companies are in the range of $ 108,581 per year 2M View Profile.... Article provides a brief overview of the traffic that competitors are getting this. The applications are natively unified applications that accelerate R & D is pioneering a $ 300B greenfield data market operating! On similarity, popularity and user reviews score is based on the organizing board my. Not just engineers! organizations in Benchling as an organization will allow your lab in 2021 childhood to... My school benchling competitors s annual competition, so i was excited to participate complete list competitors...

Sydney Flooding Today, Fayetteville Technical Community College Jobs, Best Colleges For Biology Students, Who Came Up With Distraction-conflict Theory, Call Of Duty Cold War Lubyanka Evidence, Almost Like Being In Love Novel, Things To Do In Southport, Nc This Weekend, Benchling Boston Office Address, Georgia Democratic Party Leaders, Fayetteville Technical Community College Jobs,

Share with your friends









Submit